View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10104A_low_104 (Length: 329)
Name: NF10104A_low_104
Description: NF10104A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10104A_low_104 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 105; Significance: 2e-52; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 6 - 118
Target Start/End: Complemental strand, 37212956 - 37212844
Alignment:
| Q |
6 |
agaagcaaagagaaagacaactagaaggtggagaaactcaatatcttgagagacatcaaattctcaattgcctaagaactgatacctctcaaactttaat |
105 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37212956 |
agaaccaaacagaaagacaactagaaggtggagaaactcaatatcttgagagacatcaaattctcaattgcctaagaactgatacctctcaaactttaat |
37212857 |
T |
|
| Q |
106 |
ttgttatttggac |
118 |
Q |
| |
|
||||||||||||| |
|
|
| T |
37212856 |
ttgttatttggac |
37212844 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 212 - 329
Target Start/End: Complemental strand, 37212753 - 37212636
Alignment:
| Q |
212 |
aattagaattctatggaattcaaataacatgtaatttgtgaccaagtctaatcataattttcttgtgtgaaatttcaacatgcgctgctgannnnnnnng |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| | |
|
|
| T |
37212753 |
aattagaattctatggaattcaaataacatgtaatttgtgaccaagtataatcataattttcttgtgtgaaatttcaacatgcactgctgattttttttg |
37212654 |
T |
|
| Q |
312 |
caaaatcatactctacct |
329 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
37212653 |
caaaatcatactctacct |
37212636 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University