View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10104A_low_105 (Length: 328)
Name: NF10104A_low_105
Description: NF10104A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10104A_low_105 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 10 - 267
Target Start/End: Original strand, 44535079 - 44535336
Alignment:
| Q |
10 |
aagaatatagaggaaaaggttactaccaacatgagggagaagatgagaaactcatcaacttcattatcatatgatcataatgaggtaaagaaagttgagg |
109 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44535079 |
aagaaaatagaggaaaaggttactaccaacatgagggagaagatgagaaactcatcaacttcattatcatatgatcataatgaggtaaagaaagttgagg |
44535178 |
T |
|
| Q |
110 |
actcctttgaaacaaataagaagctagagaggaagactacagaagacatcaatgccagtgctgatgccttcatcaagaatttcaggaaacaactcgtgat |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44535179 |
actcctttgaaacaaataagaagctagagaggaagactacagaagacatcaatgccagtgctgatgccttcatcaagaatttcaggaaacaactcgtgat |
44535278 |
T |
|
| Q |
210 |
tcaaaggcttcaatccattgagaattatgagaaaatgcttgcaaggggtctctagcac |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44535279 |
tcaaaggcttcaatccattgagaattatgagaaaatgcttgcaaggggtctctagcac |
44535336 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 52; Significance: 8e-21; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 150 - 257
Target Start/End: Complemental strand, 2579963 - 2579856
Alignment:
| Q |
150 |
agaagacatcaatgccagtgctgatgccttcatcaagaatttcaggaaacaactcgtgattcaaaggcttcaatccattgagaattatgagaaaatgctt |
249 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||| ||||| || ||| | || || || |||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
2579963 |
agaagatatcaatgctagtgctgatgccttcattaagaactttaggcagcagcttatgcttcagaggcttcaatctattgagaattatgagaaaatgctt |
2579864 |
T |
|
| Q |
250 |
gcaagggg |
257 |
Q |
| |
|
|| ||||| |
|
|
| T |
2579863 |
gctagggg |
2579856 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University