View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10104A_low_109 (Length: 324)
Name: NF10104A_low_109
Description: NF10104A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10104A_low_109 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 1 - 324
Target Start/End: Complemental strand, 36166471 - 36166150
Alignment:
| Q |
1 |
ttgtattaaaactagaaatagaagaaatgaaataaaggcaattaaggtggatgaggtttggattcaaaaaacattagaagtgagggagacggtggtgaat |
100 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| | ||||||||||| |
|
|
| T |
36166471 |
ttgtattaaagatagaaatagaagaaatgaaataaaggcaattaaggtggatgaggtttggattcaaaaaacattagaggtgaggggg-cggtggtgaat |
36166373 |
T |
|
| Q |
101 |
tactttaggagccatgtctcatctacttgggatcggccaaagttggatggggtaaactttgcaaggctttaggaggtggaaaatgctttgttggtggcgc |
200 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||| |||| ||||||||||||| | |
|
|
| T |
36166372 |
tattttaggagccatgtctcatctacttgggatcgaccaaagttggatggggtaaactttgcaaggcttgaggaggtgggaaatactttgttggtggcac |
36166273 |
T |
|
| Q |
201 |
ctttttcacttttggaaatagaagcagtcgttttgaaaattgagggtaataaaagtatgggacccgatggtctcaattttgctttcatcaaggctttctt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36166272 |
ctttttcacttttggaaatagaagcagtcgttttgaaaattgagggtaat-aaagtatgggacccgatggtctcaattttgctttcatcaaggctttctt |
36166174 |
T |
|
| Q |
301 |
gtaccttttgaaagggaatattag |
324 |
Q |
| |
|
|||||||||||||| ||||||||| |
|
|
| T |
36166173 |
gtaccttttgaaagagaatattag |
36166150 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University