View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10104A_low_111 (Length: 324)
Name: NF10104A_low_111
Description: NF10104A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10104A_low_111 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 229; Significance: 1e-126; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 68 - 312
Target Start/End: Original strand, 21228591 - 21228835
Alignment:
| Q |
68 |
ttacatgtccaaacacaaacctctctatgtttgtttgtttatatatcaaacatctattgttaaaatcaagtaatctgataaagtattatatagtaattga |
167 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21228591 |
ttacttgtccaaacacaaacctcactatgtttgtttgtttatatatcaaacatctatagttaaaatcaagtaatctgataaagtattatatagtaattga |
21228690 |
T |
 |
| Q |
168 |
tttgaatggaatattgtaaacttgaaacaccttataagaactttcaaaatggatggttggattgtttagttttgcattctacaaaatattattcagtggt |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21228691 |
tttgaatggaatattgtaaacttgaaacaccttataagaactttcaaaatggatggatggattgtttagttttgcattctacaaaatattattcagtggt |
21228790 |
T |
 |
| Q |
268 |
gtaatgtaaaagtttgtctcaagagtcaattagctgggtcatatt |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21228791 |
gtaatgtaaaagtttgtctcaagagtcaattagctgggtcatatt |
21228835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 26 - 69
Target Start/End: Original strand, 21228523 - 21228566
Alignment:
| Q |
26 |
ggaatgagctgcgatgtcaccaacattcttacagaaaatatttt |
69 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21228523 |
ggaatgagctgcgatgtcaccaacattcttacagaaaatatttt |
21228566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 224 - 283
Target Start/End: Original strand, 10035699 - 10035758
Alignment:
| Q |
224 |
ttggattgtttagttttgcattctacaaaatattattcagtggtgtaatgtaaaagtttg |
283 |
Q |
| |
|
|||||||| || | |||||||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
10035699 |
ttggattggttcggtttgcattctacaatttattattcgctggtgtaatgtaaaagtttg |
10035758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University