View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10104A_low_118 (Length: 315)
Name: NF10104A_low_118
Description: NF10104A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10104A_low_118 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 111; Significance: 5e-56; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 111; E-Value: 5e-56
Query Start/End: Original strand, 22 - 140
Target Start/End: Complemental strand, 4824931 - 4824813
Alignment:
| Q |
22 |
atatttgacacattggttaggacacatgatgcctcgcattggtagaaacctttgccttccatattcgtcgccaaaaacccccggttgttcatgctggaat |
121 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4824931 |
atatttgacacattgtttaggacacatgatgcctcgcattggtagaaacctttgccttccatattcgtcgccaaaaacccccggttgttcatgctggaat |
4824832 |
T |
 |
| Q |
122 |
tattaaatatgttacttgt |
140 |
Q |
| |
|
||||||| ||||||||||| |
|
|
| T |
4824831 |
tattaaagatgttacttgt |
4824813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University