View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10104A_low_121 (Length: 313)
Name: NF10104A_low_121
Description: NF10104A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10104A_low_121 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 212
Target Start/End: Original strand, 44999143 - 44999350
Alignment:
Q |
1 |
agagaggcacacaaaccaagctatgggcgcaacaagcctacatacatcaacataaacaagtttatgaattataatagaacacaatcatatatagaaggaa |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
44999143 |
agagaggcacacaaaccaagctatgggcgcaacaagcctacatacatcaacataaacaagtttatgaattataatagaacacaatcatatatagaaggaa |
44999242 |
T |
 |
Q |
101 |
ggaaaaaataaataaataaagaaatgtgagaacgttatatagaaatgggaacctccattgccacaatccactgaggacaatttgatccataaactccaat |
200 |
Q |
|
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
44999243 |
ggaaaaaataaataaat----aaatgtgagaacgttatatagaaatgggaacctccattgccacaatccactgaggacaatttgatccataaactccaat |
44999338 |
T |
 |
Q |
201 |
tcgtgagcccta |
212 |
Q |
|
|
|||||||||||| |
|
|
T |
44999339 |
tcgtgagcccta |
44999350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University