View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10104A_low_125 (Length: 310)
Name: NF10104A_low_125
Description: NF10104A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10104A_low_125 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 126; Significance: 5e-65; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 126; E-Value: 5e-65
Query Start/End: Original strand, 150 - 310
Target Start/End: Complemental strand, 6261361 - 6261203
Alignment:
| Q |
150 |
cttagttacgcttaaagttcctcacctctcttctaagatgcgtgactgataaacaatataaagcaaagtggtatatttgcaaatacacctaccgtaattc |
249 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| |||| ||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
6261361 |
cttagttacacttaaagttcctcacctctcttctacgatgtgtgactgataaacaatatatagcaaagtggtatatttgcaaatacacctaccataattc |
6261262 |
T |
 |
| Q |
250 |
aacaaaaaatagaacctctttatgtcttcatcagttttctatagcaaagtggtacataaag |
310 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6261261 |
aacaaaaaatagaac--ctttttgtcttcatcagttttctatagcaaagtggtacataaag |
6261203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 124; E-Value: 9e-64
Query Start/End: Original strand, 7 - 134
Target Start/End: Complemental strand, 6262603 - 6262476
Alignment:
| Q |
7 |
aaatggaagaatttcaaggaactatgtaaaagttcagtgagaggaatagaaaataatgcattgttctgtaattttgattatgatttttcaagcttcttta |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6262603 |
aaatggaagaatttcaaggaactatgtaaaagttcagtgagaggaatagaaaataatgcattgttctgtaattttgattatgatttttcaagcttcttta |
6262504 |
T |
 |
| Q |
107 |
cacaactaagacaaatttatgtatacct |
134 |
Q |
| |
|
||||| |||||||||||||||||||||| |
|
|
| T |
6262503 |
cacaattaagacaaatttatgtatacct |
6262476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University