View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10104A_low_135 (Length: 302)
Name: NF10104A_low_135
Description: NF10104A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10104A_low_135 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 190; Significance: 1e-103; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 108 - 297
Target Start/End: Original strand, 38842423 - 38842612
Alignment:
| Q |
108 |
taacagtttttcactttgtcaggatttacaccctcaacctttaacttatttaaaccctcaatcaagtaagttatccatccaagatttattatatattatt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38842423 |
taacagtttttcactttgtcaggatttacaccctcaacctttaacttatttaaaccctcaatcaagtaagttatccatccaagatttattatatattatt |
38842522 |
T |
 |
| Q |
208 |
ccttaaaagcgatgcttatgtggcagtgatacaaaaaataccactacttgaatgtatcttgatttgttggatatcactagtgttattgat |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38842523 |
ccttaaaagcgatgcttatgtggcagtgatacaaaaaataccactacttgaatgtatcttgatttgttggatatcactagtgttattgat |
38842612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 72 - 109
Target Start/End: Original strand, 38842126 - 38842163
Alignment:
| Q |
72 |
ctgacaaatattagtaggttaatttaattgttatctta |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38842126 |
ctgacaaatattagtaggttaatttaattgttatctta |
38842163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University