View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10104A_low_139 (Length: 299)

Name: NF10104A_low_139
Description: NF10104A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10104A_low_139
NF10104A_low_139
[»] chr4 (2 HSPs)
chr4 (21-126)||(54432306-54432415)
chr4 (223-256)||(54432171-54432204)


Alignment Details
Target: chr4 (Bit Score: 93; Significance: 3e-45; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 21 - 126
Target Start/End: Complemental strand, 54432415 - 54432306
Alignment:
21 ttcaacaaacaacattgaaattctacagttgaatttatttaggatataaagggagaaaagttaacttccacaatagaa----aatatatgaatctttcaa 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    ||||||||||||||||||    
54432415 ttcaacaaacaacattgaaattctacagttgaatttatttaggatataaagggagaaaagttaacttccacaatagaaaataaatatatgaatctttcaa 54432316  T
117 gtttcatctc 126  Q
    ||||||||||    
54432315 gtttcatctc 54432306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 223 - 256
Target Start/End: Complemental strand, 54432204 - 54432171
Alignment:
223 atatcatttttcaggtttgtaaatttagaagaag 256  Q
    |||||||||||||| |||||||||||||||||||    
54432204 atatcatttttcagatttgtaaatttagaagaag 54432171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University