View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10104A_low_139 (Length: 299)
Name: NF10104A_low_139
Description: NF10104A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10104A_low_139 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 93; Significance: 3e-45; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 21 - 126
Target Start/End: Complemental strand, 54432415 - 54432306
Alignment:
| Q |
21 |
ttcaacaaacaacattgaaattctacagttgaatttatttaggatataaagggagaaaagttaacttccacaatagaa----aatatatgaatctttcaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
54432415 |
ttcaacaaacaacattgaaattctacagttgaatttatttaggatataaagggagaaaagttaacttccacaatagaaaataaatatatgaatctttcaa |
54432316 |
T |
 |
| Q |
117 |
gtttcatctc |
126 |
Q |
| |
|
|||||||||| |
|
|
| T |
54432315 |
gtttcatctc |
54432306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 223 - 256
Target Start/End: Complemental strand, 54432204 - 54432171
Alignment:
| Q |
223 |
atatcatttttcaggtttgtaaatttagaagaag |
256 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
54432204 |
atatcatttttcagatttgtaaatttagaagaag |
54432171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University