View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10104A_low_154 (Length: 290)
Name: NF10104A_low_154
Description: NF10104A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10104A_low_154 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 15 - 271
Target Start/End: Original strand, 45506266 - 45506522
Alignment:
| Q |
15 |
ggacatcactttgtctctttagaagcggggttgtccttacaaatactctaaagctcacaccggtgtttgatttagtaggaatgtaggttttagggatnnn |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45506266 |
ggacatcactttgtctctttagaagcggggtggtccttacaaatactctaaagctcacaccggtgtttgatttagtaggaatgtaggttttagggataaa |
45506365 |
T |
 |
| Q |
115 |
nnnntgtgtatttgccattatgtctggtctagagtatttataaccgatcggataaattcctctccatttgtctcacattttgccgtggaattaaggtggg |
214 |
Q |
| |
|
||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
45506366 |
aaaatgtgtatttgccattatgtctggtcgatagtatttataaccgatcggataaattcctctccatttgtctcacatcttgccgtggaattaaggtggg |
45506465 |
T |
 |
| Q |
215 |
cgagaaaccttaagggcgtaaaagatatcagaattgaagtcttcagttgtggttcct |
271 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
45506466 |
cgagaagccttaagggcgtaaaagatatcagaattgaagtattcagttgtggttcct |
45506522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University