View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10104A_low_157 (Length: 287)
Name: NF10104A_low_157
Description: NF10104A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10104A_low_157 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 5 - 261
Target Start/End: Complemental strand, 41923225 - 41922969
Alignment:
| Q |
5 |
caagaaccacctattttagagtttgatggacgtacgtttgtgatgatgattcaaaatttgtaaaatacccatctaacggacatcaacaaagactaatacg |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
41923225 |
caagaaccacctattttagagtttgatggacgtacgtttgtgatgatgattcaaaatttgtaaaatacccatctaacggacatcaacaaggactaatacg |
41923126 |
T |
|
| Q |
105 |
aagttgacaataatatcaattttatttcataagtgagtagccgatgaatactttgcttcccgtgaatatccattgtaatctctactcttaatcctccccg |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
41923125 |
aagttgacaataatatcaattttatttcataagtgagtagccgatgaatactttgcttcccgtgaatatccattgtaatctctactcttaattctccccg |
41923026 |
T |
|
| Q |
205 |
tctccatccctgtcattcttcaacttgttctctctgaaatgagacatctctctctct |
261 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41923025 |
tctccatccctgtcatttttcaacttgttctctctgaaatgagacatctctctctct |
41922969 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University