View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10104A_low_158 (Length: 287)
Name: NF10104A_low_158
Description: NF10104A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10104A_low_158 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 162; Significance: 2e-86; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 52 - 254
Target Start/End: Complemental strand, 34051232 - 34051030
Alignment:
| Q |
52 |
aacaatatgatatgttttggctaagaatgtaaatgtggaccnnnnnnngaaggaattgaatgtgatgaaaaaatatgtaagatggcattgttataaaggg |
151 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
34051232 |
aacaatatgatatgttttggctaagaatgtaaatgtggaccaaaaaaagaaggaattgaatgtgatgaaaaaatatggaagatggcattgttataaaggg |
34051133 |
T |
 |
| Q |
152 |
tctgtatgtgtgaagagatagtggatagttgatacaactaccccaacgaacttttaattgttatatgtgtgggcattgaattagccaactgggaaacaac |
251 |
Q |
| |
|
| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| | |
|
|
| T |
34051132 |
tttgtatgtgtgaagagataggggatagttgatacaactaccccaacgaacttttaattgtaatatgtgtgggcattgaattagccaactgggaaacagc |
34051033 |
T |
 |
| Q |
252 |
ctt |
254 |
Q |
| |
|
||| |
|
|
| T |
34051032 |
ctt |
34051030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 40
Target Start/End: Complemental strand, 34051299 - 34051260
Alignment:
| Q |
1 |
aaatgaaacaaagtggaaataatttatgttttgctcaagt |
40 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
34051299 |
aaatgaaacaaagtggaaataatttatgtttttctcaagt |
34051260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University