View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10104A_low_162 (Length: 286)
Name: NF10104A_low_162
Description: NF10104A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10104A_low_162 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 11 - 280
Target Start/End: Complemental strand, 48839241 - 48838975
Alignment:
Q |
11 |
gaagaaaacaataaatcataaatgctactacagtaagttgcacagatagataaccaaccaattcatcttgttttgtgtatactatagtattagtgccgtg |
110 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
T |
48839241 |
gaagaaaacaataaatcataaatgctactacagtaagttgcacagata----accaaccaattcatcttgttttgtgtatactatagtattagtaccgtg |
48839146 |
T |
 |
Q |
111 |
caatgttgtccatcttcgggtctcaaaactaaactgaccatgcttatatatcgattgaattaatcacgttaaaaatagcgctagttgataagtcagtata |
210 |
Q |
|
|
||||||||| |||||||||||||||||||| ||||||||||| |||| |||||||||||||||||| |||||||||||||||||||||||||| |||||| |
|
|
T |
48839145 |
caatgttgttcatcttcgggtctcaaaactcaactgaccatgtttatctatcgattgaattaatcatgttaaaaatagcgctagttgataagt-agtata |
48839047 |
T |
 |
Q |
211 |
tattatattaatc--tataaacttattggagagcgtcgaaagtgataatgggctaaatatccatgactcacc |
280 |
Q |
|
|
||||||||||||| || ||| |||||| |||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
48839046 |
tattatattaatcgataaaaatttattgaagagcgtcgaaagtgacaatgggctaaatatccatgactcacc |
48838975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University