View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10104A_low_176 (Length: 276)
Name: NF10104A_low_176
Description: NF10104A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10104A_low_176 |
 |  |
|
| [»] scaffold0005 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 242; Significance: 1e-134; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 1 - 270
Target Start/End: Complemental strand, 30750730 - 30750461
Alignment:
| Q |
1 |
gaacataccccaacaagcatcaataaataatatagcttctctaaattcttgaaaccctagcttcaatccttgcaccaattccttgcttcttgctcaccca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||| |||||||| |
|
|
| T |
30750730 |
gaacataccccaacaagcatcaataaataatatagcttctctaaattcttgaaaccctaacttgaatccttgcaccaattccttgcttcttcctcaccca |
30750631 |
T |
 |
| Q |
101 |
ttaacatttaaatcttctttaggtcgagtgagaggataagaaatatggataggagtgtttataattctggtttttaattacaaatttgaggcacaaacaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30750630 |
ttaacatttaaatcttctttaggtcgagtgagacggtaagaaatatggataggagtgtttataattctggtttttaattacaaatttgaggcacaaacaa |
30750531 |
T |
 |
| Q |
201 |
tctaaaacacatgcatccaatcttcttagtgggaggtgaagattagatggttctcccatggtgatgaaga |
270 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30750530 |
tctaaaacacatgcatccaactttcttagtgggaggtgaagattagatggttctcccatggtgatgaaga |
30750461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 1 - 73
Target Start/End: Complemental strand, 30760624 - 30760552
Alignment:
| Q |
1 |
gaacataccccaacaagcatcaataaataatatagcttctctaaattcttgaaaccctagcttcaatccttgc |
73 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
30760624 |
gaacataccccaacaagcatcaataaataatatagcttctctaaattcttgaaaccctaacttcaatccttgc |
30760552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 66 - 112
Target Start/End: Complemental strand, 241546 - 241500
Alignment:
| Q |
66 |
atccttgcaccaattccttgcttcttgctcacccattaacatttaaa |
112 |
Q |
| |
|
|||||||||| ||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
241546 |
atccttgcacaaattccttgcttcttcctcacccatcaacatttaaa |
241500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 66 - 112
Target Start/End: Original strand, 14575829 - 14575875
Alignment:
| Q |
66 |
atccttgcaccaattccttgcttcttgctcacccattaacatttaaa |
112 |
Q |
| |
|
|||||||||| ||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
14575829 |
atccttgcacaaattccttgcttcttcctcacccatcaacatttaaa |
14575875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University