View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10104A_low_178 (Length: 275)
Name: NF10104A_low_178
Description: NF10104A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10104A_low_178 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 4 - 265
Target Start/End: Original strand, 22124322 - 22124583
Alignment:
| Q |
4 |
atgtataatgaataatttgttgtgatttggtaggtgctaggcttcaagtgcaatgacaattccgattctccaaagggacgtcggcacttccattactctg |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
22124322 |
atgtataatgaataatttgttgtgatttggtaggtgctaggcttcaagtgcaatgacaattccgattctccaaagggacgtcagcacttccattactcta |
22124421 |
T |
 |
| Q |
104 |
taaaaaagaatgttttatctttcttattattttggtttggatttgatatttgagttgtatgtaatgtattatgtatgcaacatcatgttatgaaagcttc |
203 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22124422 |
taaaaaagaatgttttgtctttcttattattttggtttggatttgatatttgagttgtgtgtaatgtattatgtatgcaacatcatgttatgaaagcttc |
22124521 |
T |
 |
| Q |
204 |
cctatcaagaattttaagaccttgtttttactttgacnnnnnnnctattttggaataagaaa |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
22124522 |
cctatcaagaattttaagaccttgtttttactttgacttcttttctattttggaataagaaa |
22124583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University