View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10104A_low_181 (Length: 273)
Name: NF10104A_low_181
Description: NF10104A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10104A_low_181 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 1 - 272
Target Start/End: Original strand, 6917650 - 6917921
Alignment:
| Q |
1 |
ataataatattgatcacaaacactcagtttccactaagagatggtgcagggccaagtgataagtaatttttgcactatttgatgactgttcttggcacac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6917650 |
ataataatattgatcacaaacactcagtttccactaagagatggtgcagggccaagtgataagtaatttttgcactatttgatgactgttcttggcacat |
6917749 |
T |
 |
| Q |
101 |
atgcatgctgtttccacgcctgtgttatggttggttgagaggctatgatgttaacataatttgtccactggtgttgaaaagtcaaatggcttatgtcatg |
200 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6917750 |
atgcatgatgtttccacgcctgtgttatggttggttgagaggctatgatgttaacataatttgtccactggtgttgaaaagtcaaatggcttatgtcatg |
6917849 |
T |
 |
| Q |
201 |
agaacaacaaggttacatggtcgtttccaagatcaatggtaaaggttaaaaacttgaagtaatggtaatttg |
272 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
6917850 |
agaacaacaaggttacatggtcatttccaagatcaacggtaaaggttaaaaacttgaagtaatggtaatttg |
6917921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University