View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10104A_low_183 (Length: 271)
Name: NF10104A_low_183
Description: NF10104A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10104A_low_183 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 23 - 271
Target Start/End: Original strand, 41983035 - 41983284
Alignment:
| Q |
23 |
atgcttttctttattcaaatacaaaatgattgctatgaggtgcttctctctctgcatgtaactaagatagaagataacatggacagatgtttggatcctc |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41983035 |
atgcttttctttattcaaatacaaaatgattgctatgaggtgcttctctctctgcatgtaactaagatagaagataacatggacagatgtttggatcctc |
41983134 |
T |
|
| Q |
123 |
tacggccctactaaggctccaaggaaatctcagacgaaggattgatctgac-ggtttcgagatcaaaatttgattggttagattaatccaataagcgata |
221 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
41983135 |
tacggccctactaaggctccaacaaaatctcagacgaaggattgatctgacgggtttcgagatcaaaatttgattggttagattaatccaataagcgaga |
41983234 |
T |
|
| Q |
222 |
ttaggcagaaaaaggtggaacgctaaagaggatccaagtcatgtaggtgg |
271 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
41983235 |
ttaggcagaaaaagatggagcgctaaagaggatccaagtcatgtaggtgg |
41983284 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University