View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10104A_low_209 (Length: 259)
Name: NF10104A_low_209
Description: NF10104A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10104A_low_209 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 143; Significance: 3e-75; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 1 - 175
Target Start/End: Complemental strand, 8216804 - 8216632
Alignment:
| Q |
1 |
gtagctttgttatgtctatttgatttagtgcagtgctggtttttggtnnnnnnngcaacatgatccatgcacaatatttaaatcgtatatggaatcgaac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8216804 |
gtagctttgttatgtctatttgatttagtgcagtgctggtttttggtaaaaaaagcaacatgatccatgcacaatatttaaatcgtatatggaatcgaac |
8216705 |
T |
|
| Q |
101 |
ctacaacacttcccagcttgttgtatgattatttcactattaaactctttgagaaagaaacaatatgcttctctc |
175 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
8216704 |
ctacaacacttcccagcttgttgtatgattatttcactattaaactc--tgagaaagaaacaatatgcttctctc |
8216632 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 198 - 252
Target Start/End: Complemental strand, 8216610 - 8216556
Alignment:
| Q |
198 |
atatcgaaagtaaaatcactttttattttcctacttatttggtatggaacacgaa |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
8216610 |
atatcgaaagtaaaatcactttttattttcctacttatttggtatggaaaacgaa |
8216556 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University