View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10104A_low_218 (Length: 254)
Name: NF10104A_low_218
Description: NF10104A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10104A_low_218 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 35 - 254
Target Start/End: Original strand, 40626100 - 40626319
Alignment:
| Q |
35 |
tgaacaatcaacctcttccagcttcatccatgagtcgcacctttagcaggaccaatcctttttcagaaagatacaaaatgttttgtgacaacaacacttc |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40626100 |
tgaacaatcaacctcttccagcttcatccatgagtcgcacgtttagcaggaccaatcctttttcagaaagatacaaaatgttttgtgacaacaacacttc |
40626199 |
T |
|
| Q |
135 |
ttgtgctctctctcttctgtcatcaccagtaccacaaacacatgatcatcctgaaaatggattgaatcagatggtgaatactcgctcatcttttatgcaa |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
40626200 |
ttgtgctctctctcttctgtcatcaccagtaccacaaacacatgatcatcctgaaaatggattgaatcagatggtgaatactcactcatcttttatgcaa |
40626299 |
T |
|
| Q |
235 |
cccttaggcttgagtttgca |
254 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
40626300 |
cccttaggcttgagtttgca |
40626319 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University