View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10104A_low_224 (Length: 253)
Name: NF10104A_low_224
Description: NF10104A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10104A_low_224 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 233
Target Start/End: Original strand, 19190387 - 19190619
Alignment:
| Q |
1 |
gttttggtggtggttatggttccgatgaccgttctggtggtggttatggcgctaatgaccgttatgagagtggatatgggcgttctgggggtggatatgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
19190387 |
gttttggtggtggttatggttccgatgaccgttctggtggtggttatggcgctaatgaccgttatgagagtggatatgggcgttctggtggtggatatgg |
19190486 |
T |
|
| Q |
101 |
tgatggagggcgtacgagtattggtggatatggcgaagaaaaccgttctagtggtggctatggatatggagggcgttctagtggttacggtaatgagcaa |
200 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19190487 |
tgatggagggcgttcgagtattggtggatatggcgaagaaaaccgttctagtggtggctatggatatggagggcgttctagtggttacggtaatgagcaa |
19190586 |
T |
|
| Q |
201 |
agttttggagggtatggtagggatggtcgtgat |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
19190587 |
agttttggagggtatggtagggatggtcgtgat |
19190619 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University