View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10104A_low_227 (Length: 251)
Name: NF10104A_low_227
Description: NF10104A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10104A_low_227 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 248
Target Start/End: Complemental strand, 9417274 - 9417027
Alignment:
| Q |
1 |
aacaaaatattgtgtcaacagacaaatatcaaaattgttaggcttgaaactatgatcaaattcatagggtcattgtgtctaacctaatattgtattcata |
100 |
Q |
| |
|
|||||||||||||| ||||||||| ||| ||| ||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
9417274 |
aacaaaatattgtgccaacagacacataacaatattgttaggctagaaactatgatcaaattcatagggtcattgtgtctaacataatattgtattcata |
9417175 |
T |
|
| Q |
101 |
ttgcatgaaattggtagccatacagtaatatcactaacttttttatatagttttaaaattcaactcttcaatttttgtaaaaagaaatgttcaaacaaaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9417174 |
ttgcatgaaattggtagccatacagtaatattactaacttttttatatagttttaaaattcaactcttcaatttttgtaaaaagaaatgttcaaacaaaa |
9417075 |
T |
|
| Q |
201 |
agattattgaagttgaagtcacgcatatgattccatattcttcgacat |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
9417074 |
agattattgaagttgaagtcacgcatatgattccataatcttccacat |
9417027 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University