View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10104A_low_229 (Length: 251)
Name: NF10104A_low_229
Description: NF10104A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10104A_low_229 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 1329674 - 1329436
Alignment:
| Q |
1 |
tcttcggctggttcctctggtggtggaagggccttgacttcattcatatcctcttccggttcaggttcgggttcgggttccttggcttcttcatccgaat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1329674 |
tcttcggctggttcctctggtggtggaagggccttgactgcattcatatcctcttccggttcaggttcgggttcgggttccttggcttcttcatccgaat |
1329575 |
T |
|
| Q |
101 |
tgttctcttcttgaacatcagctttattgctttgtgctagcatgttcttatctttgataaactcttccataacctctaacttctttggtgtgaccttatc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1329574 |
tgttctcttcttgaacatcagctttattgctttgtgctagcatgttcttatctttgataaactcttccataacctctaacttctttggtgtgaccttatc |
1329475 |
T |
|
| Q |
201 |
tatctcagggtactcagaagagcgacaaattccaatatt |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1329474 |
tatctcagggtactcagaagagcgacaaattccaatatt |
1329436 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University