View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10104A_low_234 (Length: 250)
Name: NF10104A_low_234
Description: NF10104A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10104A_low_234 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 112; Significance: 1e-56; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 80 - 191
Target Start/End: Complemental strand, 43922096 - 43921985
Alignment:
| Q |
80 |
gatgaaaatcaaggtttcaatttctatctccttttttattcatttcacctctcttattatcatcgatcgcactagaatccgtaattgcaccactagtatc |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43922096 |
gatgaaaatcaaggtttcaatttctatctccttttttattcatttcacctctcttattatcatcgatcgcactagaatccgtaattgcaccactagtatc |
43921997 |
T |
 |
| Q |
180 |
ttatcgattcta |
191 |
Q |
| |
|
|||||||||||| |
|
|
| T |
43921996 |
ttatcgattcta |
43921985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University