View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10104A_low_241 (Length: 250)
Name: NF10104A_low_241
Description: NF10104A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10104A_low_241 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 17 - 237
Target Start/End: Original strand, 45929488 - 45929708
Alignment:
Q |
17 |
gagaagatcctgaagcatgtcaatcatatttgagaatgagaaaccgggatggaaagtacaatcttatgtttgaggttaggtcattgaaaacacacttgtc |
116 |
Q |
|
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
45929488 |
gagaagaccctgaagcatgtcaatcatatttgagaatgagaaaccgggatggaaagtacaatcttatgtttgaggttaggtcattgaaaacacacttgtc |
45929587 |
T |
 |
Q |
117 |
tgaattggtgatatgatatgtatttattttatgccaatgcttcactcataatagtgctcttgtccttctgctgtgagataaaaaattgtcctatcttttt |
216 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
T |
45929588 |
tgaattggtgatatgatatgtatttattttatgccaatgcttcactcataatagtgctcttgtccttctgctgtgagataaaaaatagtcctatcttttt |
45929687 |
T |
 |
Q |
217 |
gagcaagcagttttctactct |
237 |
Q |
|
|
||||||||||||||||||||| |
|
|
T |
45929688 |
gagcaagcagttttctactct |
45929708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University