View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10104A_low_250 (Length: 248)
Name: NF10104A_low_250
Description: NF10104A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10104A_low_250 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 9 - 248
Target Start/End: Complemental strand, 49420338 - 49420099
Alignment:
| Q |
9 |
gaagaaaatcaaggaacccaacaaccttcacccatctctttaatttgaacaaacaaaaatcataaaccaaaattttgattttgtgttacaatgacataac |
108 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49420338 |
gaagaaaatcaaggaacccaacaatcttcacccatctctttaatttgaataaacaaaaatcataaaccaaaattttgattttgtgttacaatgacataat |
49420239 |
T |
 |
| Q |
109 |
agtggtagatttatcatgtgaataacatgctgacatctttatttggatgagtttctccaatctagttttgattttttcaaagatcttaaacttgggtagt |
208 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
49420238 |
agtggtagatttatcatgtgaataacacgctgacatttttatttggatgagtttctccaatctagttttgattttttcaaagatcttaaacttgagtcac |
49420139 |
T |
 |
| Q |
209 |
gattatgatcaagatgatgaactttgcaactgtaacattg |
248 |
Q |
| |
|
|||| ||||| |||||| ||||||||||| ||| |||||| |
|
|
| T |
49420138 |
gattttgatcgagatgaagaactttgcaaatgtcacattg |
49420099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University