View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10104A_low_261 (Length: 246)
Name: NF10104A_low_261
Description: NF10104A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10104A_low_261 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 21 - 242
Target Start/End: Original strand, 23235214 - 23235435
Alignment:
| Q |
21 |
cagacctaatgcaaggcggaaggattccaatgcaaggcaatcaagagaggggagagtaaggcatctaggacgcgacataatgactattcagtagtgtttg |
120 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
23235214 |
cagacctaatgcaaggcggaaggactccaatgcaaggcaatcaagagaggggagagtgaggcatctaggacgggacataatgactattcagtagtgtttg |
23235313 |
T |
|
| Q |
121 |
attattattagcgtgttttgtttaccattgtaatgtgctcccaaagcatatctaaagctaatgcatgaaatagttgagtttctatgacaattttaacttt |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
23235314 |
attattattagcgtgttttgtttaccattgtaatgtgctcccaaagcacatctaaagctagtgcatgaaataattgagtttctatgacaattttaacttt |
23235413 |
T |
|
| Q |
221 |
tttgaactctcaaaaccctttt |
242 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
23235414 |
tttgaactctcaaaaccctttt |
23235435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University