View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10104A_low_264 (Length: 245)
Name: NF10104A_low_264
Description: NF10104A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10104A_low_264 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 1 - 233
Target Start/End: Original strand, 51295453 - 51295670
Alignment:
| Q |
1 |
acgatctcttttatctaaagtaggtatcaacacaccaaacgaaaatcttaaagagatgccataagtatatgggtttttctcatttcaccctttcatgcca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
51295453 |
acgatctcttttatctaaagtaggtatcaacacaccaaacgaaaatcttaaagagatgccataagtatatgggtttttctcatttcaccctttcacgcca |
51295552 |
T |
|
| Q |
101 |
aacattattgagtttgatcatgtgtcacttattgtgagatagaggggtgaacttctatatttggtcttacttgtcataattgattattctatatcatatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51295553 |
aacattattgagtttgatcatgtgtcac---------------ggggtgaacttctatatttggtcttacttgtcataattgattattctatatcatatt |
51295637 |
T |
|
| Q |
201 |
aatttttcatattagaattgatgtgtggatatt |
233 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |
|
|
| T |
51295638 |
aattttttatattagaattgatgtgtggatatt |
51295670 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University