View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10104A_low_276 (Length: 242)
Name: NF10104A_low_276
Description: NF10104A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10104A_low_276 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 4 - 242
Target Start/End: Original strand, 40688205 - 40688443
Alignment:
| Q |
4 |
aatattaggttattgactatacttataatatcgatgtggaattacatgcaattttgctcatagtttggttttgatcacttgggatattggagtaacggtt |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
40688205 |
aatattaggttattgactatacttataatatcgatgttgaattacatgcaattttgctcatagtttggttctgatcacttgggatattggagtaacggtt |
40688304 |
T |
 |
| Q |
104 |
ttaaggaagccatttgtgaatctaactgcaagactatctccaatctgatagaatctgagtgtaaggaataatcctatatacattcatccttatgctccca |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
40688305 |
ttaaggaagccatttgtgaatctaactgcaagactatctccaatctgatagaatctgagtgtaaggaataatcctatatacactcatccttatgctccca |
40688404 |
T |
 |
| Q |
204 |
tcattcaatatgttagatcctttatgaatgcctctaatt |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40688405 |
tcattcaatatgttagatcctttatgaatgcctctaatt |
40688443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University