View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10104A_low_279 (Length: 242)
Name: NF10104A_low_279
Description: NF10104A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10104A_low_279 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 19 - 221
Target Start/End: Complemental strand, 43804858 - 43804656
Alignment:
| Q |
19 |
cttaacattcaagataggttgcacccacaaagtttttctcccataaatatttcatatgcgtcccttacgcaaatctcaattccaatctaattgtgctgct |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
43804858 |
cttaacattcaagataggttgcacccacaaagtttttctcccataaatatttcatatgcgtcccttaagcaaatctcaattccaatctaattgtgctgct |
43804759 |
T |
|
| Q |
119 |
cagaaatagacgtgtcgctgccatgtttgaccattctgaacaggctgttgtagacgagcagcctgcccattttcctgatgcaccaccctccactctctaa |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
43804758 |
cagaaatagacgtgtcgctgccatgtttgaccattctgaacaggctgttgtagacgagcagcctgtccattttcctgatgcaccaccctccactctctaa |
43804659 |
T |
|
| Q |
219 |
gta |
221 |
Q |
| |
|
||| |
|
|
| T |
43804658 |
gta |
43804656 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University