View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10104A_low_281 (Length: 241)
Name: NF10104A_low_281
Description: NF10104A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10104A_low_281 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 26 - 220
Target Start/End: Complemental strand, 8939284 - 8939090
Alignment:
| Q |
26 |
tttggtgtttattactcattttcagcttcaattgttgattttcaggactctgtcataaagatacttgatgctttgtaccgtgatagaaattatgcaaggt |
125 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8939284 |
tttgttgtttattactcattttcagcttcaattgttgattttcaggactctgtcataaagatacttgatgctttgtaccgtgatagaaattatgcaaggt |
8939185 |
T |
 |
| Q |
126 |
tttttgtgcttgaaactatagcaagagtcccttattttggtaagttctattttctaaatcatgcttacgcctttcaaatattaatctgttaaact |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||| |
|
|
| T |
8939184 |
tttttgtgcttgaaactatagcaagagtcccttattttggtaagttctattttctatatcatgcttacgcctttcaaatatccatctgttaaact |
8939090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University