View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10104A_low_283 (Length: 241)
Name: NF10104A_low_283
Description: NF10104A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10104A_low_283 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 43703297 - 43703074
Alignment:
| Q |
1 |
gaatgtgcgtgaatcacaaaaactaaattttgaatcctatacctcttgctcaagggatccgaggcccttcaagtcggaccaactcatgttggtgataaaa |
100 |
Q |
| |
|
|||| ||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||| |
|
|
| T |
43703297 |
gaatttgcttgattcacaaaaactaaattttgaatcctatacctcttgctcaagggatccgagccccttcaagtcggaccaactcatgttggcgataaaa |
43703198 |
T |
|
| Q |
101 |
gtaatgtgaataaaaccaagtttaaactttgtagtgaaataaagtatgttttattttgctcaaaaagcaagtctaacatgaaactttggtgtaaatttct |
200 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43703197 |
gtaatgtgaataaaacaaagtttaaactttgtagtgaaataaagtatgttttattttgctcaaaaagcaagtctaacatgaaactttggtgtaaatttct |
43703098 |
T |
|
| Q |
201 |
ctgcataagtgtaactgttgatgt |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
43703097 |
ctgcataagtgtaactgttgatgt |
43703074 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University