View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10104A_low_295 (Length: 236)
Name: NF10104A_low_295
Description: NF10104A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10104A_low_295 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 103; Significance: 2e-51; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 1 - 111
Target Start/End: Complemental strand, 27889545 - 27889435
Alignment:
| Q |
1 |
ggtaagagttgaaaaaatcctgaatgtgactaaatgttaagtaaaggagaaagagactttgaagaagcagtggtgtgaacaaagaaagaatgacaagaac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
27889545 |
ggtaagagttgaaaaaatcctgaatgtgactaaatgttaagtaaaggggaaagagactttgaagaagcagtggtgtgaacaaagaaagaacgacaagaac |
27889446 |
T |
 |
| Q |
101 |
cttgaaataca |
111 |
Q |
| |
|
||||||||||| |
|
|
| T |
27889445 |
cttgaaataca |
27889435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 169 - 236
Target Start/End: Complemental strand, 27889390 - 27889323
Alignment:
| Q |
169 |
acatctcaccttgtcattgttttgttcaataaatattctaacatttctcacatgttattatatatttt |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27889390 |
acatctcaccttgtcattgttttgttcaataaatattctaacatttctcacatgttattatatatttt |
27889323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University