View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10104A_low_301 (Length: 235)
Name: NF10104A_low_301
Description: NF10104A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10104A_low_301 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 91; Significance: 3e-44; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 17 - 172
Target Start/End: Original strand, 18704469 - 18704624
Alignment:
| Q |
17 |
catcaaacaatgacagtctttccagtccccttatatcttcagcttgatgctgagacacaatgttattcactagtagagtagnnnnnnnnnnnggctcttg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||| ||||| |
|
|
| T |
18704469 |
catcaaacaatgacagtctttccagtccccttatatcttcagcttgatgctgagacacaatgttatacactaatagagtagtttttttggctctttcttg |
18704568 |
T |
|
| Q |
117 |
tatgtgattgaacattcatagtttaagagaaatggaatgccaaagatgcttgtatt |
172 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||| ||||||||||||||| |
|
|
| T |
18704569 |
tatgtgattgaacattcatattttaagagaaatggcatgcaaaagatgcttgtatt |
18704624 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University