View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10104A_low_301 (Length: 235)

Name: NF10104A_low_301
Description: NF10104A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10104A_low_301
NF10104A_low_301
[»] chr5 (1 HSPs)
chr5 (17-172)||(18704469-18704624)


Alignment Details
Target: chr5 (Bit Score: 91; Significance: 3e-44; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 17 - 172
Target Start/End: Original strand, 18704469 - 18704624
Alignment:
17 catcaaacaatgacagtctttccagtccccttatatcttcagcttgatgctgagacacaatgttattcactagtagagtagnnnnnnnnnnnggctcttg 116  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||              |||||    
18704469 catcaaacaatgacagtctttccagtccccttatatcttcagcttgatgctgagacacaatgttatacactaatagagtagtttttttggctctttcttg 18704568  T
117 tatgtgattgaacattcatagtttaagagaaatggaatgccaaagatgcttgtatt 172  Q
    |||||||||||||||||||| |||||||||||||| |||| |||||||||||||||    
18704569 tatgtgattgaacattcatattttaagagaaatggcatgcaaaagatgcttgtatt 18704624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University