View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10104A_low_311 (Length: 232)
Name: NF10104A_low_311
Description: NF10104A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10104A_low_311 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 50362475 - 50362699
Alignment:
| Q |
1 |
ttactaatacaataatatctcatgattgttatatttgtgtaggttcactaatgcaatttttgaaggtttttattgcgagagaaagatatgttaattattg |
100 |
Q |
| |
|
||||| || |||||||||||||||||||| |||| ||||| ||||||||||||||||||||| |||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
50362475 |
ttactgatgcaataatatctcatgattgtcatatatgtgtgggttcactaatgcaatttttggaggtttatattgcgagagaaagatatgtcaattattg |
50362574 |
T |
 |
| Q |
101 |
gagtttcaggactgtttttgcaaggcatttggcaaacatgtatggaggtttttgcttatttgttgaagttaaaataaatactgaagtaggaaggaagata |
200 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||| ||||||||| |||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
50362575 |
gagtttcaggactgttgttgcaaggcatttggcaaacatgtatggagatttttgcttctttgttgaagttaa---aaatactgaagtaggaaggaagata |
50362671 |
T |
 |
| Q |
201 |
atgtagttgttgaggatactggtttatg |
228 |
Q |
| |
|
|| ||||||||| | ||||||||||||| |
|
|
| T |
50362672 |
atttagttgttgggtatactggtttatg |
50362699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 111 - 202
Target Start/End: Complemental strand, 11290998 - 11290907
Alignment:
| Q |
111 |
actgtttttgcaaggcatttggcaaacatgtatggaggtttttgcttatttgttgaagttaaaataaatactgaagtaggaaggaagataat |
202 |
Q |
| |
|
||||||||||||||| ||||||| | | |||||| ||| |||||||||||||||| ||| |||||| | ||| |||||||| ||||||| |
|
|
| T |
11290998 |
actgtttttgcaaggtatttggctagcttgtatgaaggcttttgcttatttgttgcggttgaaataaggatagaaataggaaggcagataat |
11290907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University