View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10104A_low_315 (Length: 231)
Name: NF10104A_low_315
Description: NF10104A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10104A_low_315 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 8216841 - 8217065
Alignment:
| Q |
1 |
aaaaccgtctctactcctccaataatcatttattcaaaataactctaaaaccaacatcaaattgaaagataatgtcacagtattctagggtggtgagcaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
8216841 |
aaaaccgtctctactcctccaataatcatttattcaaaataactctaaaaccaacatcaaattgaaagataatgtcacactattctagggtggtgagcaa |
8216940 |
T |
 |
| Q |
101 |
tatggtttgtgttgattttcagtattaatttgagagacacgcagtattaactttgctctatttgaattggggaaagaaattcataacgcatgtatgggcc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8216941 |
tatggtttgtgttgattttcagtattaatttgagagacacgcagtattaattttgctctatttgaattggggaaagaaattcataacgcatgtatgggcc |
8217040 |
T |
 |
| Q |
201 |
ttgaacttgacatcatatcgcatgt |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
8217041 |
ttgaacttgacatcatatcgcatgt |
8217065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 31 - 69
Target Start/End: Complemental strand, 8255495 - 8255457
Alignment:
| Q |
31 |
tattcaaaataactctaaaaccaacatcaaattgaaaga |
69 |
Q |
| |
|
|||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
8255495 |
tattcaaaataaatttaaaaccaacatcaaattgaaaga |
8255457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University