View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10104A_low_326 (Length: 230)
Name: NF10104A_low_326
Description: NF10104A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10104A_low_326 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 37 - 219
Target Start/End: Complemental strand, 27289680 - 27289493
Alignment:
| Q |
37 |
gcacttcttttctatacatttgatagaatgttcttgtcgagactactagcggaaacattggcagtggcattcattgcagcttacaagctaacattaacaa |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27289680 |
gcacttcttttctatacatttgatagaatgttcttgtcgaaactactagcggaaccattggcagtggcattcattgcagcttacaagctaacattaacaa |
27289581 |
T |
 |
| Q |
137 |
tgccggcttccatgagccttgatagaagaattttgcttcgcacttttgtagc-----tgagctgcatatcacggatcctgctaggctt |
219 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
27289580 |
tgccggcttccatgagccttgagagaagaattttgcttcacacttttgtagctgaggtgagctgcatatcacggatcctgctaggctt |
27289493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University