View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10104A_low_331 (Length: 230)
Name: NF10104A_low_331
Description: NF10104A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10104A_low_331 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 4 - 230
Target Start/End: Original strand, 51294975 - 51295201
Alignment:
| Q |
4 |
agtaagcacatcacatgaatgaaattaactttgcagtcatatagctagatcatttggtgtctaccttataacgttctacttttctagtgcgaatctgtaa |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51294975 |
agtaagcacatcacatgaatgaaattaactttgcagtcatatagctagatcatttggtgtctaccttataacgttctacttttctagtgcgaatctgtaa |
51295074 |
T |
|
| Q |
104 |
ctttggtatacctacagaaaaagcactggattccctttcctttgtgtcaatatttcagctttagggacaacagtaaccctcattgttctcgtatttatcc |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51295075 |
ctttggtatacctacagaaaaagcactggattccctttcctttgtgtcaatatttcagcttttgggacaacagtaaccctcattgttctcgtatttatcc |
51295174 |
T |
|
| Q |
204 |
gattattagattatagttagttagaga |
230 |
Q |
| |
|
|||||||||| |||||||||||||||| |
|
|
| T |
51295175 |
gattattagactatagttagttagaga |
51295201 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University