View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10104A_low_347 (Length: 230)
Name: NF10104A_low_347
Description: NF10104A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10104A_low_347 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 112; Significance: 9e-57; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 1 - 136
Target Start/End: Complemental strand, 19407272 - 19407137
Alignment:
| Q |
1 |
gcacttagaaataacatataattatttttcgaaataattgattcaatctttctcacagctacacatatgcaaacgacactttggaacccatggttggcga |
100 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
19407272 |
gcacttagaaatgacatataattatttttcgaaataattgattcaatttttctcacagctacacatatgcaaacgacacttctgaacccatggttggcga |
19407173 |
T |
|
| Q |
101 |
caaaggttccgagtacaatcttcatcagtagagcag |
136 |
Q |
| |
|
|| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
19407172 |
cataggttccaagtacaatcttcatcagtagagcag |
19407137 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University