View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10104A_low_355 (Length: 229)
Name: NF10104A_low_355
Description: NF10104A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10104A_low_355 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 211; Significance: 1e-116; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 5337099 - 5336877
Alignment:
| Q |
1 |
ttaattatttaagcatgaattatgtgtgagaaagtccatctagttatttccgtatctgttcgatagttggtagtagtatatcatgtcttgcatacctcac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5337099 |
ttaattatttaagcatgaattatgtgtgagaaagtccatctagttatttccgtatctgtttgatagttggtagtagtatatcatgtcttgcatacctcac |
5337000 |
T |
|
| Q |
101 |
gggttgaacttaaagcaagggttatgtgttaaaacatatttcttactagacagtatggttagatatgttttttgtctctatgtaattggtattagttatt |
200 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
5336999 |
gggttgaacttaaagcgagggttatgtgttaaaacatatttcttactagacagtatggttagatatgttttttgtctctatgtaattggcattagttatt |
5336900 |
T |
|
| Q |
201 |
taaagttttatattagttatttt |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
5336899 |
taaagttttatattagttatttt |
5336877 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 180 - 221
Target Start/End: Complemental strand, 5376743 - 5376702
Alignment:
| Q |
180 |
atgtaattggtattagttatttaaagttttatattagttatt |
221 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||| ||||| |
|
|
| T |
5376743 |
atgtaattgttattggttatttaaagttttatattaattatt |
5376702 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 180 - 221
Target Start/End: Complemental strand, 5428488 - 5428447
Alignment:
| Q |
180 |
atgtaattggtattagttatttaaagttttatattagttatt |
221 |
Q |
| |
|
||||||||| ||||||||||||| |||||||||||| ||||| |
|
|
| T |
5428488 |
atgtaattgctattagttatttagagttttatattatttatt |
5428447 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University