View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10104A_low_356 (Length: 229)
Name: NF10104A_low_356
Description: NF10104A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10104A_low_356 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 50 - 223
Target Start/End: Original strand, 43703392 - 43703564
Alignment:
| Q |
50 |
caattttataaacttatgttcatctaaaaccacctttatcgaacacttgcccaaatgcacactctttttcgtattgataatgaattacttttgttggttc |
149 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||| |
|
|
| T |
43703392 |
caattttataaacttatgtttatctaaaaccacctttatcgaacacttgcccaaatgcacactttttttcgtattgataatgaattacttttgtt-gttc |
43703490 |
T |
|
| Q |
150 |
aaccacctacattgaggaatcaaaatactagttgagtttgtcttgtgagattcttatcttgtgattggtccatc |
223 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43703491 |
aaccatctacattgaggaatcaaaatactagttgagtttgtcttgtgagattcttatcttgtgattggtccatc |
43703564 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University