View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10104A_low_360 (Length: 228)
Name: NF10104A_low_360
Description: NF10104A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10104A_low_360 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 1 - 218
Target Start/End: Complemental strand, 6236580 - 6236366
Alignment:
| Q |
1 |
ttgatgtaattctgccttttctgtttttgtttcttcctgatgtagaccttgttatgggttctggccctctctagttttattgaatttcttcgcttgatcn |
100 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
6236580 |
ttgatgtaattctgccttttctatttttgtttcttcctgatgtagactttgttatgggttctggccctcttcagttttattgaatttcttcgcttgat-- |
6236483 |
T |
|
| Q |
101 |
nnnnnnnnnnnnnnttagattttcacctatcacctaggttttcaatttccattaactaaagcgaaaggggaaatatggtttcgtagacttcttctacttt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6236482 |
-aaaaaaaaaaaaattagattttcacctatcacctaggttttcaatttctattaactaaagcgaaaggggaaatatggtttcgtagacttcttctacttt |
6236384 |
T |
|
| Q |
201 |
tgttgaatgtgggaacac |
218 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
6236383 |
tgttgaatgtgggaacac |
6236366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 115 - 218
Target Start/End: Original strand, 33891807 - 33891906
Alignment:
| Q |
115 |
ttagattttcacctatcacctaggttttcaatttccattaactaaagcgaaaggggaaatatggtttcgtagacttcttctacttttgttgaatgtggga |
214 |
Q |
| |
|
||||||||||||| || | |||||||||||||| ||||||||| |||| ||||||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
33891807 |
ttagattttcacccataaactaggttttcaatta----taactaaagtgaaaagggaaatatggtttctaggacttcttttacttttgttgaatgtgggg |
33891902 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 115 - 218
Target Start/End: Complemental strand, 33952441 - 33952342
Alignment:
| Q |
115 |
ttagattttcacctatcacctaggttttcaatttccattaactaaagcgaaaggggaaatatggtttcgtagacttcttctacttttgttgaatgtggga |
214 |
Q |
| |
|
||||||||||||| || | |||||||||||||| ||||||||| |||| ||||||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
33952441 |
ttagattttcacccataaactaggttttcaatta----taactaaagtgaaaagggaaatatggtttctaggacttcttttacttttgttgaatgtgggg |
33952346 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University