View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10104A_low_366 (Length: 227)
Name: NF10104A_low_366
Description: NF10104A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10104A_low_366 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 41103121 - 41102900
Alignment:
| Q |
1 |
gttaaccaattttgaatgggcgattcagaaggaatcttcgaagattccggtaccaggcggaggaatccatcctctcacacgctatgtcatgaactacatc |
100 |
Q |
| |
|
||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41103121 |
gttaaccgattttgaatcggcgattcagaaggaatcttcgaagattccggtaccaggcggaggaatccatcctctcacacgctatgtcatgaactacatc |
41103022 |
T |
|
| Q |
101 |
gcacttctcgccgattacagcgaagcaatcggcgatatagtttccgattggccacaaactccggtaccggaatcttactacaaaagtccaattcacgacg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41103021 |
gcacttctcgccgattacagcgaagcaatcggcgatatagtttccgattggccacaaactccggtaccggaatcttactacaaaagtccaattcacgacg |
41102922 |
T |
|
| Q |
201 |
aggataatccaccgtcggagat |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
41102921 |
aggataatccaccgtcggagat |
41102900 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University