View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10104A_low_367 (Length: 227)
Name: NF10104A_low_367
Description: NF10104A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10104A_low_367 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 63; Significance: 2e-27; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 4 - 74
Target Start/End: Complemental strand, 1140706 - 1140636
Alignment:
| Q |
4 |
caaacacacttcacttcataacatggtttctaaataacaaaagcgttgcataccaatcatatcccacctct |
74 |
Q |
| |
|
|||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||| |
|
|
| T |
1140706 |
caaacacacttcacttcataacatggtttctataaaacaaaagcgttgcataccaatcatatcccacctct |
1140636 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 146 - 227
Target Start/End: Complemental strand, 1140475 - 1140394
Alignment:
| Q |
146 |
gactcaaactaactttcacatgtatttctcttttgatattaaaatggaaacttacacactagagagagatgggttccatagg |
227 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||| ||||| | |||||||||||||||||||||||||||| |
|
|
| T |
1140475 |
gactcaaactaactttcacatgaatttctcttttgatattaaaaaagaaacattcacactagagagagatgggttccatagg |
1140394 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 88 - 149
Target Start/End: Complemental strand, 1140577 - 1140516
Alignment:
| Q |
88 |
ttttgatataactgtttctttctttctaactatttggttgtcattgattggatgtagggact |
149 |
Q |
| |
|
|||| |||||| ||||||||||||| |||||||||||||||||||||||||||| ||||||| |
|
|
| T |
1140577 |
ttttaatataaatgtttctttctttataactatttggttgtcattgattggatgcagggact |
1140516 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University