View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10104A_low_375 (Length: 226)
Name: NF10104A_low_375
Description: NF10104A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10104A_low_375 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 139; Significance: 7e-73; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 20 - 162
Target Start/End: Complemental strand, 41429536 - 41429394
Alignment:
| Q |
20 |
ataactcgtctttacaggaaaactcaaacattctatcattaaaactgtcaatttgtaacaactcaatgcatttgggtgatcactgacgggtcactatatt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41429536 |
ataactcgtctttacaggaaaactcaaacattctatcattaaaactgtcaatttgtaacaactcaatgcatttgggtgatcactgacgggtcactatatt |
41429437 |
T |
 |
| Q |
120 |
atagatcaggttggatttgccaaattaattacgaaccagtttt |
162 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
41429436 |
atagatcaggttggatttgcccaattaattacgaaccagtttt |
41429394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 146 - 206
Target Start/End: Complemental strand, 41429369 - 41429309
Alignment:
| Q |
146 |
aattacgaaccagttttccatcttattttcgttcttttgattttttgacatatgaattttc |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41429369 |
aattacgaaccagttttccatcttattttcgttcttttgattttttgacatatgaattttc |
41429309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University