View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10104A_low_377 (Length: 225)
Name: NF10104A_low_377
Description: NF10104A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10104A_low_377 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 25 - 207
Target Start/End: Complemental strand, 55654648 - 55654467
Alignment:
Q |
25 |
taagatcacgtcaccaatatgatgatggtagagttggcaacatcactttacttagaaaaacaatctaggttcaattcatggagtcgcacatttggaagat |
124 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
55654648 |
taagatcacgtcaccaatatgatgatggtagagttggcaacatcactttacttagaaaaacaatctaggttcaattcatggagtcgcacatttggaagat |
55654549 |
T |
 |
Q |
125 |
atagtattagcgatcgttaactcaaaaattaatcttatagcggattcaaattggtcaatatatacaagagtgtgtttgatatt |
207 |
Q |
|
|
||||| || |||||||||||| ||||||||||||||||| ||||| |||||||||||||||||| ||||||||||||||||| |
|
|
T |
55654548 |
atagt-ctaacgatcgttaacttaaaaattaatcttatagtggatttaaattggtcaatatatacgagagtgtgtttgatatt |
55654467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University