View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10104A_low_378 (Length: 225)
Name: NF10104A_low_378
Description: NF10104A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10104A_low_378 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 54 - 208
Target Start/End: Original strand, 17811995 - 17812148
Alignment:
| Q |
54 |
gttcttctccactggaagggggatggtgtacctgcactgcacgcgccccgacactctctttcttgaacccctcacttctccagccatctatgcctggggt |
153 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||||||||||| | || | |||||||| |||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
17811995 |
gttcttctccaccggaaggggggtggtgtacctgcactgcatgtgctctgacactct--ttcttgaacccctcacttctccagccatctattcctggggt |
17812092 |
T |
|
| Q |
154 |
acggacatgagtaa-ccctcggggtggtaaggagctctcggattaatggtgaggaa |
208 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
17812093 |
acggacatgagtaacccctcggggtggtgaggagctctcggattaatggtgaggaa |
17812148 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 38; Significance: 0.000000000001; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 23 - 64
Target Start/End: Complemental strand, 1841529 - 1841488
Alignment:
| Q |
23 |
ggtttgaaatcgaaaaaggtccctcggagaagttcttctcca |
64 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
1841529 |
ggtttgaaatcgaaaaaggttcctcggagaagttcttctcca |
1841488 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 23 - 64
Target Start/End: Complemental strand, 1824229 - 1824188
Alignment:
| Q |
23 |
ggtttgaaatcgaaaaaggtccctcggagaagttcttctcca |
64 |
Q |
| |
|
|||||||||||||||||||| ||||| | ||||||||||||| |
|
|
| T |
1824229 |
ggtttgaaatcgaaaaaggttcctcgtaaaagttcttctcca |
1824188 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University