View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10104A_low_382 (Length: 224)
Name: NF10104A_low_382
Description: NF10104A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10104A_low_382 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 26 - 201
Target Start/End: Original strand, 35603674 - 35603848
Alignment:
| Q |
26 |
agtctcataaagcttaccctaaatctcgttattttctatgatggccggcaaaccttcggtacatataatatatgagtatggcgagaggggacatctttgt |
125 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35603674 |
agtctcataaagcttaccctaaatctcgttattttttatgatggccggcaaaccttcggtacatataatatatgagtatggcgagaggggacatctttgt |
35603773 |
T |
 |
| Q |
126 |
cggagaactctttcaggagtaattggtccattgtgaacatccattaaaaatgacctgatattctacagtagagata |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
35603774 |
cggagaactctttcaggagtaattggtccattgtgaacat-cattaaaaatgacatgatattctacagtagagata |
35603848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University