View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10104A_low_384 (Length: 223)
Name: NF10104A_low_384
Description: NF10104A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10104A_low_384 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 89; Significance: 5e-43; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 24 - 145
Target Start/End: Original strand, 33092442 - 33092559
Alignment:
| Q |
24 |
taggactctcacaaatttcacttgattcttcttttgcttagtgacaagcgagacaatttcttgctccatatatagtcttaagacatgcattcatcaagta |
123 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||| |||||||||||||||||||||||||||||| |
|
|
| T |
33092442 |
taggattctcacaaatttcacttgattcttcttttgcttagtgacaagcgagagaattttttgctc----tatagtcttaagacatgcattcatcaagta |
33092537 |
T |
|
| Q |
124 |
gaccttcgacacacaactgaga |
145 |
Q |
| |
|
||| |||||||||||||||||| |
|
|
| T |
33092538 |
gacattcgacacacaactgaga |
33092559 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 31 - 145
Target Start/End: Original strand, 1182174 - 1182284
Alignment:
| Q |
31 |
ctcacaaatttcacttgattcttcttttgcttagtgacaagcgagacaatttcttgctccatatatagtcttaagacatgcattcatcaagtagaccttc |
130 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| ||| |||||||||| |||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
1182174 |
ctcacaaatttcacttgattcgtcttttgcttagtgaaaagtgagacaattttttgctccata----gtcttaagacatgcattcatcaagtagaccttc |
1182269 |
T |
|
| Q |
131 |
gacacacaactgaga |
145 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
1182270 |
gacacacaactgaga |
1182284 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 143 - 189
Target Start/End: Original strand, 33092602 - 33092648
Alignment:
| Q |
143 |
agaatgttcacatcatcatattattggatctcaaagcaaaatctaac |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33092602 |
agaatgttcacatcatcatattattggatctcaaagcaaaatctaac |
33092648 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University