View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10104A_low_389 (Length: 222)
Name: NF10104A_low_389
Description: NF10104A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10104A_low_389 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 51; Significance: 2e-20; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 25 - 94
Target Start/End: Complemental strand, 38420091 - 38420021
Alignment:
| Q |
25 |
tgaatccagcattagacatgcatgatcgtt-aaaacttataaagtgttatgaaattgatccttaacattgc |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |||||||||| || ||||||||||||||||||||| |
|
|
| T |
38420091 |
tgaatccagcattagacatgcatgatcgttaaaaaattataaagtgctaagaaattgatccttaacattgc |
38420021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 159 - 222
Target Start/End: Complemental strand, 38419963 - 38419900
Alignment:
| Q |
159 |
tgttttgtattactttacaagtgtgtctttacatggcaatgtaaatcctatttgtaggatacaa |
222 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||| |||||||| |||||||| || ||||||| |
|
|
| T |
38419963 |
tgttttgtattacttcacaaatgtgtctttacatgacaatgtaactcctatttatacgatacaa |
38419900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 159 - 222
Target Start/End: Complemental strand, 28874292 - 28874229
Alignment:
| Q |
159 |
tgttttgtattactttacaagtgtgtctttacatggcaatgtaaatcctatttgtaggatacaa |
222 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||| || |||| |||||||| |||||||||| |
|
|
| T |
28874292 |
tgttttgtattacttcacaagtgtgtctttatatgacagtgtaggtcctatttataggatacaa |
28874229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 163 - 221
Target Start/End: Complemental strand, 20125372 - 20125314
Alignment:
| Q |
163 |
ttgtattactttacaagtgtgtctttacatggcaatgtaaatcctatttgtaggataca |
221 |
Q |
| |
|
||||||||||| ||||||||||| |||||| ||||| || |||||||| ||||||||| |
|
|
| T |
20125372 |
ttgtattacttcacaagtgtgtcattacattgcaatatatgtcctatttataggataca |
20125314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 163 - 221
Target Start/End: Complemental strand, 15553024 - 15552966
Alignment:
| Q |
163 |
ttgtattactttacaagtgtgtctttacatggcaatgtaaatcctatttgtaggataca |
221 |
Q |
| |
|
||||||||||| ||||||||||| |||||| ||||| || |||||||| ||||||||| |
|
|
| T |
15553024 |
ttgtattacttcacaagtgtgtcattacattgcaatataggtcctatttataggataca |
15552966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 167 - 222
Target Start/End: Complemental strand, 19699546 - 19699490
Alignment:
| Q |
167 |
attactttacaagtgtg-tctttacatggcaatgtaaatcctatttgtaggatacaa |
222 |
Q |
| |
|
||||||||||||||||| |||||||||| ||||||| || ||||| |||||||||| |
|
|
| T |
19699546 |
attactttacaagtgtgttctttacatgacaatgtatgtcatatttataggatacaa |
19699490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 163 - 222
Target Start/End: Original strand, 24228296 - 24228356
Alignment:
| Q |
163 |
ttgtattactttacaagtgtgt-ctttacatggcaatgtaaatcctatttgtaggatacaa |
222 |
Q |
| |
|
||||||||||| |||||||||| |||||||| |||| || ||||||||| |||||||||| |
|
|
| T |
24228296 |
ttgtattacttcacaagtgtgtactttacattacaatatagatcctatttataggatacaa |
24228356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University