View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10104A_low_391 (Length: 222)
Name: NF10104A_low_391
Description: NF10104A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10104A_low_391 |
 |  |
|
| [»] scaffold1034 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold1034 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: scaffold1034
Description:
Target: scaffold1034; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 21 - 202
Target Start/End: Original strand, 1506 - 1700
Alignment:
| Q |
21 |
atgtataatagcaagcaatttgccacatcnnnnnnnntttggtactgtcaaacatcaagca-------------cctaagatcaaacattgtgatctgat |
107 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
1506 |
atgtataatagcaagcaatttgccacatcaaaaaaaatttggtactgtcaaacatcaagcatccacatccaggacctaagatcaaacattgtgatctgat |
1605 |
T |
 |
| Q |
108 |
ctccctttctttcacaacataaatgttgctgagacctctactaccccttcacaatcacaactgcaatttcaacatgatcacaactgcaactccaa |
202 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
1606 |
ctccctttctttcacaacataaatgttgccgagacctctactaccccttcacaatcacaactgcaatttcaacatggtcacaactgcaactccaa |
1700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University